Everything below concerns stationary phase. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Last reviewed on 2026-05-15. Where a claim depends on a specific study, the study is described rather than over-claimed.
Routine HPLC testing compares a sample result with a calibration curve prepared from known reference standards. Peak area or peak height is plotted against concentration, and the curve is used to estimate unknown amounts. Retention time supports tentative identification when compared with a standard, though mass spectrometry or another confirmatory method may be needed for definitive identification. Pre-run checks verify repeatability, resolution, and peak symmetry before sample analysis. Limits of detection and quantification describe the smallest amounts that can be reliably observed or measured. Sample preparation, filtration, and degassing help prevent column damage and inconsistent results.
High-performance liquid chromatography is an analytical technique that separates components in a liquid sample. A pump moves a liquid mobile phase through a column packed with a solid stationary phase. Compounds interact differently with both phases and travel at different rates, leaving the column at distinct retention times. A detector records these arrivals as peaks on a chromatogram. The resulting pattern supports identification and quantification of substances in mixtures. Modern instruments use high pressure to force solvent through small particles, which improves speed and resolution compared with older low-pressure liquid chromatography methods.
Separation in HPLC depends on the chemistry of the stationary phase, the composition of the mobile phase, and the physical properties of the column. Reverse-phase separations use a nonpolar stationary phase and a polar mobile phase, and they are common for many organic compounds. Ion-exchange, size-exclusion, and normal-phase modes serve other classes of analytes. Gradient elution changes solvent strength over time, while isocratic elution holds it constant. Flow rate, temperature, particle size, and column length all influence peak shape and resolution. Detection may use ultraviolet absorbance, fluorescence, refractive index, or mass spectrometry, depending on the analyte and the required sensitivity.
Validation establishes that a method is suitable for its intended purpose. Typical parameters include accuracy, precision, specificity, linearity, range, limit of detection, limit of quantification, robustness, and stability of standards and samples. Acceptance criteria are defined in advance, and results are documented in a validation report. Regulatory guidance for pharmaceuticals, foods, and environmental testing differs, so the applicable framework must be identified. Ongoing verification uses control samples and trend charts after validation. Method transfer to another laboratory may require partial revalidation.
Routine quality control includes blanks, duplicates, spiked samples, and certified reference materials. Calibration curves are prepared with standards at several concentrations, and the detector response is checked for linearity. Carryover, column aging, mobile phase evaporation, and temperature drift can shift retention times or peak areas. Maintenance such as replacing seals, filters, and columns helps prevent failures. Records of injections, integration, and deviations support traceability. Audits may request raw data and instrument logs for each batch.
| Property | Value | Notes |
|---|---|---|
| Common abbreviation | HPLC | High-performance liquid chromatography |
| Separation basis | Differential partitioning | Between liquid mobile phase and solid stationary phase |
| Common mode | Reverse phase | Nonpolar column, polar mobile phase |
| Typical detector | UV-Vis absorbance | Widely used for compounds with chromophores |
| Typical column particle size | 2–5 µm | Smaller particles can improve resolution |
Key performance measures include retention time, peak area, peak height, resolution, tailing factor, and plate count. Retention time helps identify a peak under fixed conditions, but confirmation often requires a second method or detector. Peak area and height relate to concentration through calibration curves, which may be linear or nonlinear depending on the detector response. Resolution describes separation between adjacent peaks, while tailing factor and plate count describe peak shape and column efficiency. Performance checks verify these values before and during a run to confirm that the instrument is performing within limits.
High-performance liquid chromatography testing separates components of a liquid sample by forcing a mobile phase through a packed column. The stationary phase inside the column interacts with analytes to different degrees, so each compound exits at a characteristic retention time. A pump delivers solvent at controlled flow and pressure, while an injector introduces a precise sample volume. Detectors such as ultraviolet-visible, fluorescence, refractive index, or mass spectrometric instruments record the separated bands. The resulting chromatogram provides qualitative and quantitative information about the mixture.
=== Anti-inflammation === Inhibiting inflammatory mediators could help prevent osteoarthritis progression. Cytokines and chemokines are both crucial in stimulating cartilage catabolism and blocking these inflammatory mediators. Studies have shown that treatment with NF-κB pathway inhibitor BAY11-7082 restores IL-1b-inhibited chondrogenesis of cartilage stem cells and in turn postpones progression of OA. Similarly, ample research shows that combined blockade of TNFa and IL-17 with bispecific antibodies reveals an inhibition of both cytokines for reduced cartilage degradation and proinflammatory responses.
Compound C00074 at KEGG Pathway Database. Enzyme 2.7.1.40 at KEGG Pathway Database. Compound C00022 at KEGG Pathway Database. Click on genes, proteins and metabolites below to link to respective articles.
In 1470, one of these weavers, known in France as Jean Le Calabrais, invented the prototype of a Jacquard-type loom. It was able to work the yarns faster and more precisely. Charles V of Spain formally recognized the growth of the silk industry of Catanzaro in 1519 by allowing the city to establish a consulate of the silk craft, charged with regulating and checking the various stages of production. At the time, the city declared that it had over 500 looms. By 1660, when the town had about 16,000 inhabitants, its silk industry ran 1,000 looms, and employed at least 5,000 people. The silk textiles of Catanzaro were sold at the kingdom's markets and were exported to Venice, France, Spain and England. Entire communities of Albanians migrated to towns in northern Calabria, called by the king of Naples in recognition of the services that Albanian leader Gjergj Kastrioti Skanderbeg had rendered to the crown against the Angevins. After 1478 the sovereign allowed these refugees fleeing the Turkish advance in Albania after Skanderbeg's demise to occupy abandoned villages to repopulate them, granting them royal privileges and franchises: hence the Arbëreshë community was born. In the 16th century, Calabria was characterized by demographic and economic development, driven by increasing demand for silk products. After the relative pacification, Calabria followed the historical and political events of the Kingdom of Naples, enduring struggles between France and Spain, for territorial control of the Italian peninsula.
A diplomatic crisis began in 2025 when the Donald Trump's second presidency of the United States administration sought to annex Greenland, an autonomous territory of the Danish Realm—a treaty ally of the United States and co-member of NATO, and a member of the European Union (EU). The crisis intensified in early 2026 when Trump refused to rule out the use of military force for this annexation and threatened a 25% import tax on goods from several European nations unless Denmark ceded the territory to the United States. Denmark's refusal was supported by the EU and several other NATO members, reigniting earlier concerns of a US–EU trade war. Within weeks, Trump backed down, pledging not to use force or tariffs to annex Greenland. Trump had tried to purchase Greenland during his first presidency. After his 2024 re-election, in January 2026, he said "it may be a choice" whether to preserve NATO or seize Greenland, and in Dear Jonas, a letter leaked by Norwegian Prime Minister Jonas Gahr Støre, Trump had said that he "no longer [felt] an obligation to think purely of Peace" after not receiving the Nobel Peace Prize. A report by the Danish Defence Intelligence Service mentioned the United States as a potential threat to national security for the first time in its history, and Danish officials raised concerns about reports that Director of National Intelligence Tulsi Gabbard had assigned agents to spy on Greenland. The Greenlandic and Danish prime ministers rejected any American takeover, saying they would defend Greenland in the event of an attack.
Sources: en.wikipedia.org
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Naram-Sin defeated Manium of Magan, and various northern hill tribes in the Zagros, Taurus, and Amanus Mountains, expanding his empire up to the Mediterranean Sea. His "Victory Stele" depicts his triumph over Satuni, chief of Lullubi in the Zagros Mountains. The Sumerian King List gives the length of his reign as 56 years, and at least 20 of his year-names are known, referring to military actions against various places such as Uruk and Subartu. One unknown year was recorded as "the Year when Naram-Sin was victorious against Simurrum in Kirasheniwe and took prisoner Baba the governor of Simurrum, and Dubul the ensi of Arame". Other year names refer to his construction work on temples in Akkad, Nippur, and Zabala. He also built administrative centers at Nagar and Nineveh. In general it is not possible to assign an order to Naram-Sin's year name with the exception of his first "The year Naram-Sin received a weapon of heaven/An fr[om] the temple of the god Enlil". It is, however, possible to divide them into those before his deification and after that event (assumed to be shortly after the "Great Revolt") based on the presence of a godhood determinant in his name. During his reign Naram-Sin increased direct royal control of its city-states. He maintained control over the various city-states by the simple expedient of appointing some of his many sons as key provincial governors, and his daughters as high priestesses. He also reformed the scribal system. A few loyal local governors remained in place.
=== Industries === Leeds has since attracted investment from financial institutions, to become a recognised financial centre, with many banks, building societies and insurance companies having offices in the city. Wakefield has also attracted many service-based industries, in particular call centres. Two of the big four supermarkets are from West Yorkshire. Morrisons is based in Bradford, while Asda is based in Leeds. West Yorkshire grew up around several industries. Wakefield, Castleford, Pontefract and South and East Leeds were traditional coal mining areas.
A retrospective study of patients with CRKp and CSKp infection asserted that the use of cephalosporins (a class of β-lactam antibiotics) used before invasive procedures was higher in patients with CRKp infection, suggesting that it is a risk factor. In a three-year study, the prevalence of CRE was shown to be proportional to the lengths of stays of the patients in those hospitals. Policies regarding contact precaution for patients infected or colonized by gram-negative pathogens were also observed in hospitals reporting decreases in CRE prevalence. One case study showed that patients with a compromised immune response are especially susceptible to both CRE exposure and infection. In one study, an elderly patient with acute lymphoblastic leukemia being treated in a long-term care facility contracted a CRE infection. Her age and condition, combined with her environment and regulation by a catheter and mechanical ventilation, all contributed to a higher susceptibility. Another major risk factor is being in a country with unregulated antibiotic distribution. In countries where antibiotics are over-the-counter and obtainable without a prescription, the incidence and prevalence of CRE infections were higher. One study from Japan found that 6.4% of healthy adults carried ESBL (mostly cefotaximase)-producing strains compared to 58.4% in Thailand, where antibiotics are available over the counter and without prescription. An Egyptian research group found that 63.3% of healthy adults were colonized.
In 1991, the central government authorized Shanghai to begin economic reforms. Since then, the port has expanded rapidly. By 2005, the Yangshan deep-water port had been built on the Yangshan islands, a group of islands in Hangzhou Bay linked to Shanghai by the Donghai Bridge. This development allowed the port to overcome shallow water conditions in its current location and to rival another deep-water port, the nearby Port of Ningbo-Zhoushan. The port is part of the 21st Century Maritime Silk Road that runs from the Chinese coast to Singapore, towards the southern tip of India to Mombasa, from there through the Red Sea via the Suez Canal to the Mediterranean, there to the Upper Adriatic region to the northern Italian hub of Trieste with its connections to Central Europe and the North Sea.
Sources: en.wikipedia.org
HPLC testing measures the presence and amount of one or more compounds in a liquid sample. It separates mixture components and records detector responses as peaks, which are compared with reference standards. Results are usually reported as concentrations or relative percentages.
Retention time is the interval between sample injection and the detector response for a given compound. It depends on the compound's interactions with the stationary and mobile phases under set conditions. Matching a retention time to a standard supports tentative identification but is not always unique.
HPLC alone can separate unknown compounds and provide retention times, but it often cannot identify them with certainty. Coupling HPLC to mass spectrometry gives mass information that improves identification. Confirmation usually requires comparison with reference standards or complementary techniques.
System suitability is a set of checks performed before and during a run to confirm that the instrument, column, and method work as expected. Common checks include resolution, tailing factor, theoretical plates, and relative standard deviation of replicate injections. Failure triggers troubleshooting or method adjustment.